Quiabentia
Quiabentia es un género de la familia Cactaceae estrechamente emparentado con Pereskiopsis, perteneciente a la familia Cactaceae. Consta de 5 especies.

Esto es un extracto del artículo Quiabentia de la enciclopedia libre Wikipedia. En Wikipedia hay disponible una lista de los autores.
En los últimos 30 días se ha accedido 63 veces al artículo Quiabentia en es.wikipedia.org. (Versión: 13.08.2013)
Imágenes de Quiabentia
Vista previa:
Original:
Resultados de la búsqueda de Google y Bing
1
>30
1
Quiabentia - Wikipedia, the free encyclopedia
... Quiabentia pflanzii · Quiabentia verticillata · Quiabentia zehntneri. Quiabentia is a genus of cacti, closely related to Pereskiopsis. References[edit source | edit].
en.wikipedia.org/wiki/Quiabentia
2
>30
2
Quiabentia On-line Guide to the positive identification of Members of ...
Notes for the Genus: Quiabentia. Etymology - Named after the common name for the plant in Brazil -Quiabento. The single species in the genus Quiabentia is a ...
cactiguide.com/cactus/?genus=Quiabentia
3
>30
3
mis cactus: QUIABENTIA
7 Abr 2011 ... The cactus has leaves that have interested botanists for its possible primitive features, suggesting that the first cacti have been seen as such.
pinchudos.blogspot.com/2011/04/quiabentia.html
4
>30
4
Quiabentia verticillata - Cactuseros
Grusonia verticillata, Pereskia pflanzii, Pereskia verticillata, Quiabentia chacoensis, Quiabentia chacoensis var. jujuyensis, Quiabentia pereziensis, Quiabentia ...
www.cactuseros.com/Especie/16685/Quiabentia_verticillata.html
5
>30
5
Quiabentia zehntneri - The IUCN Red List of Threatened Species
Range Description: This species has been recorded from both sides of the Rio São Francisco valley, in west-central/southern Bahia and central Minas Gerais, ...
www.iucnredlist.org/details/46512/0
6
>30
6
PlantFiles: Detailed information on Quiabentia Quiabentia verticillata
Browse pictures and read growth / cultivation information about Quiabentia (Quiabentia verticillata) supplied by member gardeners in the PlantFiles database at ...
davesgarden.com/guides/pf/go/105186/
7
>30
7
Quiabentia verticillata | Facebook
Quiabentia Para el Chaco SIB (Sistema de Información de Biodiversidad) registra: Quiabentia verticillata (Vaupel) Borg. Publicada por Vaupel en un principio ...
www.facebook.com/media/set/?set=a.500111350019108.117823.179848538712059&type=3
8
>30
8
MICROINJERTO en una QUIABENTIA...!!!!! - Foro de InfoJardín
Hola mis queridos foreros!!!!! Aquí les traigo para mostrarles mi primer MICROINJERTO, y como si esto fuera poco lo he hecho usando para pie ...
www.infojardin.com/foro/showthread.php?t=282850
9
>30
9
Quiabentia — The Plant List
Statistics. The Plant List includes 7 scientific plant names of species rank for the genus Quiabentia. Of these 2 are accepted species names. The Plant List ...
www.theplantlist.org/browse/A/Cactaceae/Quiabentia/
10
>30
10
Au Cactus Francophone : Fiche de : Quiabentia Britton & Rose
10 Sep 2001 ... Au Cactus Francophone : Fiche de : Quiabentia Britton & Rose.
www.cactuspro.com/encyclo/Quiabentia
Resultados de la búsqueda para "Quiabentia"
Google: aprox. 23.100
bing: aprox. 53
Quiabentia en el ámbito científico
Quiabentia verticillata - The IUCN Red List of Threatened Species
Quiabentia verticillata is listed as Least Concern because it has a wide ... Universidad Nacional Experimental de los Llanos Occidentales “Ezequiel Zamora”.
obo:NCBITaxon_107610, Quiabentia - Berkeley BOP
Class: Quiabentia. Term IRI: http://purl.obolibrary.org/obo/NCBITaxon_107610 ... He Group University of Michigan Medical School Ann Arbor, MI 48109. UM Logo.
porteri quiabentia chacoensis Sample Search Results - OSTI
Summary: Quiabentia,but in each case the ad- ditional copy was easily ... Source: Shaffer, H. Bradley - Section of Evolution and Ecology, University of California, ...
porteri quiabentia chacoensis: Topics by WorldWideScience.org
For leafy members of the Opuntioideae (Pereskiopsis porteri, Quiabentia chacoensis, ..... Rios, Maria Yolanda [Universidad Autonoma del Estado de Morelos, ...
Cactus morph&molec 31Jan06.nex
TreeBASE has been supported by the NSF, Harvard University, and UC Davis. ... longispina' CCGCCCCACCCACCGATCATCA 'G-Quiabentia verticillata' ...
[PDF]PC11 Doc. 10.1.1 - Cites
... y el género. Pereskiopsis (todas las especies) y el género Quiabentia (todas las especies). ..... I. Universidad Nacional Autónoma de. México, México. Bravo ...
[PDF]CoP12 Prop.45 - Cites
Quiabentia Britton & Rose (subfamilia Opuntioideae Schumann), todas las especies ..... Universidad Nacional Autónoma de México, México, Vol. I. CONABIO (in ...
Taxonomy Results: Quiabentia - Arctos - museum
8 records ... Name, Common Name(s), Nomenclatural Code, Kingdom, Phylum, Class, Subclass, Order, Suborder, Superfamily, Family, Subfamily, Tribe, Genus ...
SysTax - detailed information on Quiabentia pflanzii (Vaupel) Vaupel
Quiabentia pflanzii (Vaupel) Vaupel: Anderson, E. F. (2001), [detailed view] ... Arctos - Data on northern specimen-based research (University of Alaska, ...
[PDF]Opuntia
Desert Botanical Garden. Donald Pinkava. Arizona State University ... ◇Quiabentia. ◇Tacinga. ◇Tephrocactus ... ◇Quiabentia. ◇Tacinga. ◇ Tephrocactus.
Libros sobre el término Quiabentia
Flora cactológica del estado de Querétaro: diversidad y riqueza
Flora cactológica del estado de Querétaro: diversidad y riqueza
Léia Scheinvar, 2004
... Copiapoa Neolloydia Coryphantha Thelocactus Echinocactus C a erg Subfamilia Pterocactus Pereskiopsis Quiabentia Figura 15. L e p i s m iu m Rhipsalis Schlumbergera Eriosyce Neowerdermannia Neoporteria Sclerocactus Epithelantha ...
Cien cactus argentinos
Cien cactus argentinos
Roberto Kiesling, Omar E. Ferrari, 2005
Quiabentia. verticillata. Otros nombres: 'Sacharosa hembra" (en Salta y Bolivia), " Oreja de perro", "Achuma". Verticillata significa que su ramificación es verticilada, o sea que a una misma altura del tronco nacen varias ramas. Crece en zonas ...
The Cactus Primer
The Cactus Primer
Arthur C. Gibson, 1990
2.19) and Quiabentia (Fig. 2.20) in subfamily Opuntioideae and not in subfamily Pereskioideae are well established. Opuntioids, including the large- leaved species, have glochids on the areole and a hard, bony aril that surrounds the seed.
Progreso de las búsquedas en Google


Entradas de blog sobre el término
Quiabentia
v e r d e c h a c o: Quiabentia
QuiabentiaPara el Chaco SIB (Sistema de Información de Biodiversidad) registra: Quiabentia verticillata (Vaupel) Borg Publicada por Vaupel en un principio con el nombre de Pereskia verticillata posteriormente fue reclasificada bajo el género Quiabentia. Sinónimos: Pereskia pflanzii / Pereskia verticillata / Quiabentia chacoensis / Quiabentia pflanzii.
arbolesdelchaco.blogspot.com/2012/11/quiabentia.html
mis cactus: QUIABENTIA
Los cactus que tiene hojas han interesado a los botánicos por sus posibles características primitivas,lo que sugiere que las primeras cactáceas se hayan visto como estos. Al principio, este género, se incluyó en Pereskiopsis (Hunt y Taylor, 1986, 1990).
pinchudos.blogspot.com/2011/04/quiabentia.html
Quiabentia zehntneri | Quiabentia
Quiabentia is an unusual cactus. It is rather thin for a cactus, and it has leaves. The genus was made in 1923 by Britton and Rose in their Cactaceae. It has only two species. One, Q. verticillata, is wide-spread in Argentina, Bolivia, and Paraguay. The other, Q. zehntneri, grows some 2000km away in an isolated…
quiabentia.wordpress.com/2012/10/27/quiabentia-zehntneri/
OPUNTIOIDEAE: Características de la S. Opuntioideae 2
Siguiendo con las areolas, hay un trabajo muy interesante de F. Buxbaum (creo que publicado en 1950), y reeditado más tarde por Kraintz, sobre morfología de las cactáceas.
opuntioideae.blogspot.com/2011/11/caracteristicas-de-la-s-opuntioideae-2.html
Quiabentia verticillata - Cactaceas en Peligro y Mas | Cactus de Mexico
Nombre científico: Quiabentia verticillata
cactaceasenpeligroymas.com/cactus-de-america/quiabentia-verticillata
el invernadero de martina: Cactus o cactaceas
 EVOLUCION Y ORIGEN DE LOS CACTOS EVOLUCION Pertenecen a la familia de las suculentas y son una de las plantas mas fáciles en evolucionar y de adaptar en cualquier suelo y clima. Aparecieron en la tierra hace 600.
botanicavegetal.blogspot.com/2013/02/cactus-o-cactaceas.html
Neu: Quiabentia verticillata de.wikipedia.org/... #wiki - obm-wiki, all Mµs
This page contains an inclusion of the Mµs followed by the wikis in the obm-wiki-hive . It provides the obm-wiki-all-Mµs-feed . The feed is in turn included into the page obm-list-wiki - obm-wiki, all Mµs .
obmwikiallmicrons.soup.io/post/56667777/Neu-Quiabentia-verticillata-de-wikipedia-org-wiki
Quiabentia
Il nome deriva dall'indigeno Quiabent. È un genere di cactus appartenenti allatribù delle Opuntaeae, ma ancora assai vicini alle Pereskia, dato che le foglie,pur essendo caduche, sono ovali e piuttosto grandi; nel loro habitat originarioessi formano cespugli o sono addirittura arborei, ramificando orizzontalmente.
mondosapere.blogspot.com/2010/09/quiabentia.html
Karnosas - Cactus y Suculentas: Injertos
karnosas.blogspot.com/2011/07/injertos.html
123